Human Variation and Race

High Altitude

High altitude reduces the availability of oxygen and causes hypoxia which negatively effects the survival of humans. Because the atmosphere is less dense in high altitudes, the air pressure is 30% lower than the air pressure that is available in sea level. Since the air pressure is lower, it makes it more difficult for oxygen to enter our vascular systems and causes hypoxia. Some symptoms of hypoxia include: difficulty doing physical activities, inability to memorize things or think clearly, distorted vision and loss of appetite. Hypoxia is especially dangerous for pregnant woman and child birth. In other words, hypoxia increases risks of miscarriage, mortality, low birth weight and premature birth. High altitude makes it more difficult for fetus to get enough oxygen while in the womb. Babies are not the only ones who can be affected by high altitude. In fact hypoxia affects human physiological system such as the brain, heart and lungs. Since our body is not equipped to handle a big climate change experienced in high altitude, it becomes more sensitive to health issues.

Short-term adaptations:

In order to adjust to high altitude, the heart has to pump harder and cause an increase in respiration and heart rate. Consequently, individuals who have heart issues will experience more stress when in high altitude. In order to adapt to the new conditions, our bodies will produce more red blood cells and also capillaries to carry the required amount of oxygen. Furthermore, the lungs stretch out to facilitate osmosis of oxygen and carbon dioxide. Drinking more water helps to avoid moisture to be evaporated quickly from our lungs and skin.

Facultative adaptation:

In order to decrease the level of stress for the body to produce more blood cells and capillaries to carry oxygen, our body can produce more hemoglobin (facultative adaption). I think consumption of food that contains Iron vitamin is recommended because Iron facilitates the production of hemoglobin in the body.

Developmental adaptation:

Group of people who live in high elevations are genetically more suited to pressure in high elevations and they pass their genes to the next generation. Natural selection is responsible for the DNA adaptation. In other words, generation after generation the individuals who adapt to the environmental changes continue living and give birth to the next generation. However, individuals who are not able to adapt, gradually go on extinction. The individual who live at higher altitudes tend to have larger lung capacities and larger hearts to get more oxygen. These individuals produce more hemoglobin which enables them to breath faster and carry more oxygen to the rest of the body.

Cultural adaptation:

Individuals who have hobbies such as climbing and hiking may use tools such as oxygen tanks to help them with breathing. The available oxygen enables them to climb higher without experiencing hypoxia. Besides that, having an oxygen tank reduces the need for more blood cells and capillaries to carry more oxygen. Drinking a lot of water (in daily diet) is recommended for hikers and climbers to replace the water reduction from their skin and lungs.

The risk of heart disease in individuals who live in high elevation is in half. This means that their body works harder to pump and it helps strengthen the heart and increase body endurance. Furthermore, individuals who live in high altitudes usually burn more calories and lose their appetite, consequently they lose weight.

I think studying human variation by looking at the environmental influences (and biology) on adaptations is more scientific and unbiased. I believe race is a cultural and social construct and uses biased explanations to define human variation.

Language Blog

Part 1:

I did this assignment with my fiancé. It was very interesting for both of us to communicate without using any symbolic language. It was very difficult not to use symbolic language. I was doing my best to tell her something without using any words; however, she couldn’t understand what I was trying to tell her. It was very funny and we laughed a lot. After a couple of minutes I decided to change the topic and “talk” (or communicate) about something else. I thought if I pick an easier topic she might understand my point. I think my fiancé changed the way she normally communicates with me during this assignment. She was getting frustrated towards the end of the assignment. I think she was tired of guessing what I was trying to tell her. If we were from two different cultures communicating for the first time, the culture who used symbolic language will take the lead in conversation and express his/her opinions easily. Furthermore, the culture that uses symbolic language might get irritated or discouraged to continue the conversation. On the other hand the culture that is not using symbolic language might feel inferior and powerless. Some populations in our culture who lack symbolic language include: deaf people, children with speech delay (who after years of speech therapy have complete language), individuals with sever Autism and also individuals with severe mental retardation. I think these types of individuals are often times misunderstood. For example, they might suffer from severe headache and not be able to articulate it. Since there is no two way communication available, consequently, those who use symbolic language would communicate with non symbolic language users only to provide their needs. (Occasionally they might share feelings with them or teach them how to do things).

Part 2:

Not using any body language, gesture and movements was very difficult for me. My fiancé thought it was funny to hear me talking without expressing any emotions or facial expressions. According to her, not having any facial expressions made my conversation seem sad or depressing. It was very interesting experience for both of us. She couldn’t tell how I felt regarding what I was talking about and she didn’t know how to react to my statements. Since she couldn’t tell how I felt about subject matter, she didn’t know what to ask or how to react. I remember there was a research done by some Psychologists at UCLA and they found out that 90% of our communications are non verbal. Unfortunately, I can’t remember the details of the study but I think it’s fascinating to see the importance of facial expressions and body language in our daily conversations. By doing this assignment I realized how important it is to use physical embellishments to communicate. It was really difficult not to move my hands while I was talking. Individuals with Autism Spectrum Disorder (and also Asperger) are not able to read body language. These individuals might ask questions at times (or situations) when a normally developing person would avoid to ask. Since they are not able to read body language, they might laugh at things that are not funny, or say things that are not socially appropriate. Another group of people who are not able to read body language are the blind individuals.

If someone is not able to read body language, then this individual might feel free to ask someone to do a favor even though the other person’s facial expression is showing that he/she is going to reject it. Since this individual is not able to read body language, he/she will be able to ask questions that might make the other person uncomfortable.

Piltdown Hoax

Piltdown hoax

The story of the Piltdown man begins in East Sussex. An amateur Archeologist (Charles Dawson) at the gravel pit near the village of Piltdown discovered a skull. By 1912 popular press spread the news. Many scientists were skeptical of the findings; however, they didn’t want to challenge Charles Dawson and Sir Arthur Conan Doyle. In 1953 Kenneth P. Oakley, who was a professor of Anthropology at Oxford University applied modern technology and found out that the Piltdown skulls were hoaxes. It was a combination of fragments of a medieval man’s skull, an orangutan’s jawbone and chimpanzee’s teeth. The skull was chemically treated to look older. Oakley and his researchers found out that the jaw was of a 500 year old Orangutan which was chemically aged. Microscopic studies showed that the teeth came from fossilized chimpanzee which were modified to look more human.

Prior to this finding, the hoax created distorted family tree for modern man and his ancestors.

We don’t know the person behind this act, however, Charles Dawson seems to be the prime suspect. There isn’t enough evidence that he was the perpetrator of the hoax and he died in 1916 without any confessions. Other suspects include Pierre Teillhard de Chardin (who was hired to do the digging) and Sir Arthur Conan Doyle (who was an Anatomist and the Piltdown man provided him with enough evidence for his theory on Human evolution). Martin Hinten is another suspect who was a workman at the natural museum (and became a Zoologist later).

The human fault that influenced this finding was the desire to find the earliest Englishman. This is a clear example for letting the personal interests influence the results. The hoax started because of national pride, jealousy and went on for such a long time because some people preferred to believe in it and ignore the reality.  

The positive aspect of scientific process that was responsible for revealing the skull to be fraud was Fluorine Test. By measuring the fluorine content of the fossil scientist could roughly date them. In 1949 scientists conducted a Fluorine test and found out that the remains were very young (about Hundred Thousand years old).

I don’t think removing “human factor” from science is necessary because humans are able to get educated and propose new theories. Although some theories might be rejected, the beauty of science is in its infinite opportunity to find another theory with better evidence to support a hypothesis (or reject it and look for another hypothesis).

This historical event reminded me of the importance of replication in science. In other words, science enables researchers to follow and repeat the measurements (findings) and in this case by following the measurements another scientist found the truth. I also learned not to take information in face value without any verification. This historical event is another reason why we should be critical thinkers and don’t believe in everything that we are being told.

Comparative Primate

Lemurs (Prosimians/Strepsirhini)

Lemurs live exclusively on Madagascar Island and the nearby Comoro Islands. 80% of species found at Madagascar are found nowhere else in the world. The island consists of tropical rain forests (along the eastern edge) and arid dry forests (western coast).

Lemurs are very diverse group of primates. Most Lemurs are arboreal, however; Ring-tailed lemurs are living semi-terrestrially and 25% of the time they live on the ground. Since lemurs have very diverse groups they come in different shapes and sizes. Some of them have a fairly large body size that requires a large area to obtain food.

There’s only little sexual dimorphism among Lemurs. The Black Lemur (male and female both medium-sized with an overall length of about 38inches and weight 5Lbs) shows sexual dimorphism (male is black and the female is brown with a white underside). Some female Lemurs are larger than the males.

After a big storm, Lemurs have been washed out of Africa and they landed in Madagascar.  Male and female differences are not very significant in Lemurs. The fact that they are living in small groups and their Polygynous (many females live with one male) nature of relationship may have plaid a big role in this subject matter. When Lemurs arrived to Madagascar they filled many Ecological niches and didn’t have to compete with monkeys that were living in Madagascar.  

Male and Female Lemurs

Spider Monkey (New World Monkey/Platyrrhini)

Spider Monkeys are New World monkeys that are found at Tropical and sub tropical forests of central and South America (preferably peaceful and quiet areas). Spider monkeys eat fruit, insects and also flowers. Spider monkeys have powerful tail that they use as an extra limb. Spider monkeys are among the largest of New World monkeys. They have long legs, arms and tail and this is where the word “spider” for spider monkey comes from.

Sexual dimorphism among Spider monkeys is little. The average weight for wild black spider monkey males is 10.8 kg (23.8 lb) while females weigh 9.66 kg (21.3 lb) on average. The height of male spider monkey averages 557 mm (1.83 ft) while females average 552 mm (1.81 ft)

Just like Lemurs, Spider monkeys are polygynous and this type of life style protects females and limits competition for the male. Since there is only a small competition, male monkey don’t need to adapt huge differences to attract female monkeys. This is why male and female spider monkeys look alike (have only a little sexual dimorphism).

 

Baboon (Old World Monkey/Cercopithecidae)
Baboons are found in Arabia (Savannas or other arid habitats or tropical rain forests) and Africa. Baboons are omnivores and they mostly eat roots, seeds and grasses. . Baboons range in size from 33 to 82 pounds and average 20 to 40 inches long (tail not included).

Olive Baboon, Yellow Baboon and Gelada Baboon are different types of Baboon.

Sexual Dimorphism example in Yellow Baboons: Adult males and females have longer hair along their flanks compared to the rest of their bodies while males have longer fur at the nape of their necks. Yellow baboons have a prominent brow ridge covered in yellow-gray fur, but the rest of their face appears black and is only finely covered with fur. All baboons are sexually dimorphic. Wild yellow baboon males have an average height of 1200 mm (3.94 ft) and weigh 25.8 kg (56.9 lb) while females measure 976 mm (3.20 ft) and weigh only 11.0 kg (24.3 lb), on average (Altmann et al. 1993). Variation in length and sharpness of canine teeth is also seen among males and females. Male baboons have long, sharp upper canine teeth compared to females. They use their canines in aggressive interactions with other males and when feeding on large vertebrate prey.

male and female Baboons

Gibbon (Lesser Ape/Hylobatidae)

The reason why Gibbons are called Lesser Ape is because of their small body size. Gibbons live at the rainforests at Southeast Asia. Being arboreal is an advantage for Gibbons (spend less than 1% of their time on the ground). It also has a survival value for Gibbons by keeping them away from predators. Gibbons branchiate using their long arms and thumb (adaptation).

White-Cheeked Gibbons: found in China and Vietnam.

Sexual Dimorphism: male and female are similar in body size (and also their genitalia is very similar). 18 inches tall and weighs 15 - 20 Lbs. Infants are born beige and within 6months they become black with white cheek patches. When sexual mature, male Gibbons remain black and females return beige again.

Male and Female Gibbon

Chimpanzee (Great ape/Hominidae)
Humans and Chimpanzees share about 95% to 98% same DNA. Chimpanzees are found in 22 countries across a west-east belt in equatorial Africa. chimpanzees live in a wide variety of habitat types (dry savannas, evergreen rainforests, Montane forests, swamp forests, and dry woodland-savanna mosaics). Chimpanzees use sticks, rocks and grass to make tools and use those tools to acquire and eat honey, ants, nuts, and water. Average life span for Chimpanzees is 40 to 45 years.

Chimpanzees are slightly sexually dimorphic with males, on average, weighing 40 to 60 kg (88.2 to 132 lb) and females, on average, weighing 32 to 47 kg (70.5 to 104 lb). Males and females have an average height of 816 mm (2.68 ft). Male Chimpanzees have less tolerance toward unfamiliar male Chimpanzees. They might see the unfamiliar faces as a mating competition. Chimpanzees are born with pale faces and a white tail tuft (both darken with age). Both males and females have beards and prominent ears. At night, all Chimpanzees build tree nests for safety. Female Chimpanzees have sexual swelling during estrus. Attacks (by lions and Leopards) are the number one reason for mortality among Chimpanzees. Dr. Jane Goodall contributed a lot on what we know about Chimpanzees today.

using tools

Dr. Jane Goodall and Chimpanzee

 

 

After answering the question and learning more about these 5 primates, I discovered that most of them lack sexual dimorphism. However, Baboons exhibit the greatest sexual dimorphism among the primates. The environment that each of these primates are living has influenced their body size and traits slightly. Some primates are able to swing and climb up the trees easily and they have adapted to tree living style.  

  Resources:

http://bb8.canyons.edu/webapps/portal/frameset.jsp?tab_id=_2_1&url=%2fwebapps%2fblackboard%2fexecute%2flauncher%3ftype%3dCourse%26id%3d_1584_1%26url%3d

http://nationalzoo.si.edu/Animals/Primates/Facts/FactSheets/Lemurs/default.cfm

http://pin.primate.wisc.edu/factsheets/entry/black_spider_monkey

http://nationalzoo.si.edu/Animals/Primates/Facts/FactSheets/Gibbons/default.cfm

http://bb8.canyons.edu/webapps/portal/frameset.jsp?tab_id=_2_1&url=%2fwebapps%2fblackboard%2fexecute%2flauncher%3ftype%3dCourse%26id%3d_1584_1%26url%3d

Analogy/Homology

1.     

a.    Elephant and Beaver are two species that possess homologous traits. These two species may not look the same but their homologus traits have been adapted for different roles.

b.     Beaver and Elephant they each use their teeth for different purposes. The beaver uses its teeth for chewing through tree trunks. However, the elephant use its tusks for digging, peeling bark from trees and fighting. Examinations show that each of these traits is a modification of the basic incisor tooth structure. Evolution adapted the elephant and the beaver to perform different functions. These traits are homologous structures, inherited from a common ancestor with incisor teeth.

c.     Elephants ancestor was Mammutidae and the Beavers ancestor was the Rodentia.

d.     

2.       

a.        Dolphins and sharks both have a streamlined body shape with a triangular fin on the back and two side fins These two animals may look the same but underneath their skin they are very different.

b.      Both dolphins and sharks swim after prey in the ocean. In order to swim faster they use their streamlined bodies and fins. Their streamlined bodies, flippers and dorsal fins are the result of convergent evolution. The analogous structure between the shark and dolphin is the result of the similar challenges and similar adaptations that they have faced throughout life. Nevertheless, having the analogous traits has been advantageous for them.

c.       Both Shark and Dolphin are vertebrates. Shark is a type of cartilaginous fish and Dolphin is a Mammal.

d.     

Protein Synthesis

TTCATACCAAGGGAACGGCTTGAGTGCAAGCCCCATCTTGA

Historical Influence on Darwin

1.

Thomas Malthus

2.

I think the English Economist, Thomas Malthus had the most influence on Darwin’s theory of natural selection. According to the website, evolution.berkeley.edu, Malthus believed that human population is growing rapidly and availability of resources plays a major role in population growth.

3.

All organisms have the potential of reproducing exponentially :

Just like Darwin used the example about rabbits and their reproduction, Malthus talked about flies and exponentially reproduction. According to evolution.burkely.edu website, Malthus points out that the availability of resources could be one of the reasons why we are not knee deep in flies.

Another point most directly affected by Malthus is about limited availability of resources. Malthus argued that if a family earned more money, then they would have had more children. Likewise, Darwin believed that if rabbits had more food, water and safe shelter then they would have reproduced more offspring.

According to evolution.burkeley.edu website, Malthus looked at humans as group of individuals who were subject to the same basic laws of behavior. I think this is what influenced Darwin to say that individuals do not involve, populations do.

4.

I’m not sure if Darwin could have developed his theory of natural selection without the influence and ideas of Thomas Malthus.

Malthus is the first one who raised the question about population growth and the influence of resources in human or non-human reproduction. I think Malthus’s view on human population plants the seeds for Darwin’s curiosity to the theory of natural selection. However, Malthus was an Economist and he wasn’t interested in evolution at all. In my opinion, if Malthus had looked at population growth from an evolutionist’s point of view, he might have had the same conclusion and findings as Darwin did.

5.

When Darwin wrote a short summary of the Natural Selection, he didn’t think he had enough evidence to support his argument and as a result of that he decided to publish it at a later time. Darwin’s friends and family were concerned about threats associated by his evolutionary ideas and this might be another reason why he decided to publish it at a later time.

Resource:

(http://evolution.berkeley.edu/evolibrary/article/0_0_0/history_07)